Ecological Archives E096-122-A1

Meryl C. Mims, Ivan C. Phillipsen, David A. Lytle, Emily E. Hartfield Kirk, and Julian D. Olden. 2015. Ecological strategies predict associations between aquatic and genetic connectivity for dryland amphibians. Ecology 96:13711382. http://dx.doi.org/10.1890/14-0490.1

Appendix A. Description of sampling and genetic methods as well as assessment of potential bias due to different sampling methods. Appendix A also includes sampling maps for all three species and tables describing sampling and genetic information by site and by species, microsatellite loci for red-spotted toads and canyon treefrogs, results from Hardy Weinberg exact tests, microsatellite loci characteristics, STRUCTURE results, and results of assessment of bias across sampling methods.

Amphibian sampling

Sample sites for each species are shown in Fig. A1, A2, and A3, and sample-specific information is summarized by location in Table A1. Adults were collected at breeding sites and along roadways, and larval samples were collected with dip nets from breeding ponds. Where possible, multiple spatial or temporal replicates from a given sampling locale were collected (described in the main text). These temporal and spatial replicates ("Reps") were tallied and are presented in Table A1, and the genetic implications of variability in the number of replicates are discussed later in this appendix.

Microsatellite amplification and screening

Whole genomic DNA extractions were performed using DNeasy 96 Blood & Tissue Kit (QIAGEN), and extractions were performed at the Molecular Ecology Research Lab at the University of Washington's School of Aquatic and Fishery Sciences. Mexican spadefoot loci were compiled from previously published microsatellite markers (Rice et al. 2008, Van Den Bussche et al. 2009). Canyon treefrog and red-spotted toad marker sets were developed by the Evolutionary Genetics Core Facility at Cornell University and are described in Table A2. Polymerase chain reaction (PCR) was used to amplify DNA for multiplexed loci using Multiplex PCR kits (QIAGEN). PCR products were genotyped using an ABI 3730 sequencer (Applied Biosystems) at the Oregon State University's Center for Genome Research and Biocomputing (Corvallis, OR). Genotypes were analyzed using the software GENEMAPPER 4.1 (Applied Biosystems), and alleles were binned using the program TANDEM (Matschiner and Salzburger, 2009). Loci were screened for the presence of linkage disequilibrium using the log likelihood ratio statistic for each pair of loci in each population was found (GenePop, Raymond and Rousset 1995). No evidence of consistent linkage between loci was found. Any significant pairwise linkage results occurred in < 13% of all populations for a given species; results not shown but available upon request. Loci were also screened for deviations from Hardy-Weinberg equilibrium (HWE) using the exact p-test (results presented in Table A3) as implemented in GenePop (Raymond and Rousset 1995), and the presence of null alleles was evaluated with Micro-Checker (Van Oosterhout et al. 2004) using adults only (spadefoots) or larval samples from which all but one full sibling were removed. With a Bonferroni correction applied, no significant deviations from HWE were observed for any locus in a given population for canyon treefrogs or Mexican spadefoots. Three significant deviations from HWE were observed for red-spotted toads (Table A3); however, because these deviations did not represent a considerable proportion of tests for any given population or locus, all markers and populations were retained in our analyses. Summary statistics for all retained loci (all species) are included in Table A4, including F statistics calculated using MSA 4.05 (Dieringer and Schlötterer 2003).

Larval samples can bias population genetics findings by artificially inflating genetic differentiation due to family structure (Goldberg and Waits 2010); therefore, we screened all larval samples for full siblings using the program COLONY (Wang 2009). One sibling was retained from each family with fewer than six siblings. For families with six or more full siblings, there is a 98.4% chance of detecting both parental alleles for each locus, and we manually reconstructed two parental genotypes for use in population-based analyses for samples < 25 in order to achieve the maximum sample size. For individual-based analyses, only a single sibling was retained. This was confirmed by re-genotyping rare alleles (in < 3 individuals). We estimated statistical power of our final marker sets using POWSIM, a simulation-based computer program that estimates power (and α error) for chi-square and Fisher's exact tests when evaluating the hypothesis of genetic homogeneity (Ryman and Palm 2006). Sample sizes, number of samples, loci and allelic information, and number of generations can be combined under various scenarios to produce a hypothetical degree of genetic differentiation (measured as FST). We ran simulations for each species and used our actual sample size and number of samples (conservatively calculated without reconstructed parents), our median estimated Ne, numbers of loci and alleles, and allele frequency for simulations. Number of generations was then adjusted to approximate observed FST. Each species was simulated at a range of numbers of generations from 10 to 500 to calculate power at a range of FST output values, including one that approximated the observed FST. Proportion of significant differences observed (200 runs) was 1.0 for all species in almost all scenarios. The 10-generation spadefoot simulations were the only scenario with a proportion of significant differences observed that fell below 1.0. However, the estimated FST for that run was roughly 1/10 the observed FST, indicating that a 10-generation simulation is not sufficiently long to reflect actual observed genetic differentiation for this species. These results indicate satisfactory statistical power given the loci and sample sizes in our data set.

Hierarchical population structure and clustering

Individual-based hierarchical population structure was analyzed using the Bayesian clustering program STRUCTURE 2.3.4 (Pritchard et al. 2000). Each sampling site was treated as an independent putative population with a total of n putative populations for each species. Ten iterations of each K from 1 to n + 1 for each species were run for 1,000,000 cycles with a burn-in of 200,000 cycles. We used the locprior model with admixture and correlated allele frequencies. The most likely K was determined using the delta-K method (Evanno et al. 2005) in which the most likely value of K is assessed by the second-order rate of change in the log-likelihood. A delta-K value cannot be calculated for K = 1; thus, for cases in which K = 1 has the greatest log-likelihood, 1 is assumed to be the most likely K (Spear et al. 2012). This analysis was repeated for genetic clusters in which both K > 1 and n > 1 to identify hierarchical population structure until terminal clusters were described (Phillipsen et al. 2013). All STRUCTURE output and delta-K calculations are included in Table A5. STRUCTURE output was visualized using the program DISTRUCT 1.1 (Rosenberg 2004).

Assessment of potential sampling bias from variable sampling methods

Despite accounting for larval family structure, it is possible that variable sampling methods may introduce biases into genetic inference of population structure and connectivity. For example, COLONY accounts for full-sibling groups, but it is possible that half-siblings or other distant family structure inflates genetic differentiation between larval samples relative to adult samples. Also, Mexican spadefoot adults were collected along roadways in addition to breeding sites. It is not well known whether adults of this species exhibit breeding site fidelity or homing behavior; if they do, particularly for their larval pond, it is reasonable to expect that adults collected at breeding sites may be more genetically similar than those collected along roads. To examine whether we see evidence of large bias from these variable sampling methods, we paired larval samples with nearby adult samples for red-spotted toads and spadefoots. Canyon treefrogs were not included because we did not have enough adult samples to generate a sufficient number of adult-larval paired samples. We then examined genetic diversity and overall genetic differentiation within each group of samples collected by a given method (larval samples, adult samples, breeding site adults, and roadside adults).

Allelic richness and heterozygosity were similar across sampling methods within species. We found some evidence for higher differentiation among larval samples than adult samples for red-spotted toads, where G'ST increased by 62% for larval samples compared to adult samples (Table A6). Ne was also lower for larval samples than adults. However, for spadefoots, there was modest evidence of lower genetic differentiation among larval samples than for adult samples, with G'ST reduced by 34% for larval samples compared to adult samples. Ne was also lower for adult samples than for larvae for which the median Ne value was 10,000 (the estimate for infinite population sizes). Genetic differentiation between spadefoot adult sampling methods was minimal. However, for both species, not all "pairs" of larval and adult samples were spatially congruent. Some adult and larval red-spotted toad pairs were selected based on similar sample sizes and similar spatial locations, but with local processes identified as important for this species (for example, low Ne in some populations), the pattern of higher G'ST may be spurious and requires further exploration.

We also explored the effects of multiple sampling replicates ("Reps") in space and time on genetic diversity indices. To do this, we used a paired sample approach for populations of all three species with two or more replicates (from which at least 10 % of the sampled individuals represented an additional replicate). These included 3 populations of canyon treefrogs, 6 populations of red-spotted toads, and 12 populations of spadefoots. Due to low sample sizes for two of the three species, we did not explore effects of sampling replicates on genetic differentiation between populations. Genetic diversity metrics (HO, HE, AR, Ne and the upper confidence limit of Ne (Ne high) calculated using a jackknifing approach and estimated as 10,000 for infinite values) were calculated with only one replicate and with multiple replicates. To control for sample size, multiple replicate samples were reduced to match sample sizes of one replicate only. Where possible, equal numbers of individuals were included from each replicate in the reduced sample. A paired t-test was then used to compare differences in HO, HE and AR, and a Wilcoxon signed-rank test was used to compare differences in Ne and the upper confidence interval of Ne given the non-normal distribution of differences for these values. Local processes such as drift due to low Ne or low migration rates as well as possible metapopulation dynamics were identified as playing a greater role in population genetic structure of canyon treefrogs and red-spotted toads, and the effect of multiple sampling replicates may be more apparent in species such as these with low Ne and greater family structure among larval samples. For that reason, the effect of replicates on these genetic diversity metrics was calculated for all species as well as for canyon treefrogs and red-spotted toads combined.

We found little evidence that sample replicates biased the results of this study (Table A7). We found no significant differences in genetic diversity measures between single and replicate samples for all species, and we found only one significant difference for canyon treefrog and red-spotted toads alone (HE, p value = 0.024). If a Bonferroni correction for multiple comparisons is applied, the result for HE is not significant.

In summary, although we saw differences in estimates of genetic differentiation between larval and adult samples for both species, the range of G'ST values within species were comparatively low. These potential biases did not result in overlap of G'ST between species, and thus for this study we suspect that the potential bias did not affect the outcome of this study. We also found little support for the effect of number of spatial or temporal sampling replicates on the genetic diversity metrics of this study. However, our results are limited to our study species in a subsection of their ranges, and bias due to different sampling methods may be more substantial for other species or regions. Future consideration of biases from sampling methods both in empirical and simulation studies may be particularly important for development of predictive models in which small differences in connectivity estimates may have implications for resistance surface parameterization or management actions.

Literature cited

Bowcock, A. M., A. Ruiz-Linares, J. Tomfohrde, E. Minch, J. R. Kidd, and L. L. Cavalli-Sforza. 1994. High resolution human evolutionary trees with polymorphic microsatellites. Nature 368:455–457.

Dieringer, D., and C. Schlötterer. 2003. Microsatellite analyser (MSA): a platform independent analysis tool for large microsatellite data sets. Molecular Ecology Notes 3:167–169.

Evanno, G., S. Regnaut, and J. Goudet. 2005. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Molecular Ecology 14:2611–2620.

Goldberg, C. S., and L. P. Waits. 2010. Quantification and reduction of bias from sampling larvae to infer population and landscape genetic structure. Molecular Ecology Resources 10:304–313.

Matschiner, M., and W. Salzburger. 2009. TANDEM: integrating automated allele binning into genetics and genomics workflows. Bioinformatics 25:1982–1983.

Phillipsen, I. C., and D. A. Lytle. 2013. Aquatic insects in a sea of desert: population genetic structure is shaped by limited dispersal in a naturally fragmented landscape. Ecography 36:731–743.

Pritchard, J. K., M. Stephens, and P. Donnelly. 2000. Inference of population structure using multilocus genotype data. Genetics 155:945–959.

Raymond, M., and F. Rousset. 1995. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity 86:248–249.

Rice, A. M., D. E. Pearse, T. Becker, R. A. Newman, C. Lebonville, G. R. Harper, and K. S. Pfennig. 2008. Development and characterization of nine polymorphic microsatellite markers for Mexican spadefoot toads (Spea multiplicata) with cross-amplification in plains spadefoot toads (S. bombifrons). Molecular Ecology Resources 8:1386–1389.

Rosenberg, N. A. 2004. Distruct: a program for the graphical display of population structure. Molecular Ecology Notes 4:137–138.

Ryman, N., and S. Palm. 2006. POWSIM: a computer program for assessing statistical power when testing for genetic differentiation. Molecular Ecology 6:600–602.

Spear, S. F., C. M. Crisafulli, and A. Storfer. 2012. Genetic structure among coastal tailed frog populations at Mount St. Helens is moderated by post-disturbance management. Ecological Applications 22:856–869.

Van Den Bussche, R. A., J. B. Lack, C. E. Stanley, J. E. Wilkinson, P. S. Truman, L. M. Smith, and S. T. McMurry. 2009. Development and characterization of 10 polymorphic tetranucleotide microsatellite markers for New Mexico spadefoot toads (Spea multiplicata). Conservation Genetics Resources 1:71–73.

Van Oosterhout, C., W. F. Hutchinson, D. P. M. Wills, and P. Shipley. 2004. MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4:535–538.

Wang, I. J. 2009. A new method for estimating effective population sizes from a single sample of multilocus genotypes. Molecular Ecology 18:2148–2164.

 

FigA1

Fig. A1. Canyon treefrog sampling map.


 

FigA2

Fig. A2. Red-spotted toad sampling map.


 

FigA3

Fig. A3. Mexican spadefoot sampling map.


 

Table A1. Sample number and locations (UTM Zone 12); sample size with siblings removed (N All), with reconstructed parents (N with P), and with number and percent of adults; replicates (temporal or spatial); allelic richness (based on minimum sample size); expected and observed heterozygosity; effective population size (Ne) and the 95% confidence intervals for Ne calculated via a jackknifing method where "Inf" represents infinity; and FIS values averaged over all loci. Results from Hardy Weinberg exact tests are included in Table A3. Additional information by locus and/or population are available from M.C. Mims upon request.

Canyon treefrog

Site

UTM
Northing

UTM
Easting

N
All

N
with P

N
Adults

Percent Adults

Reps

AR

HE

HO

Ne

C.I.s for Ne

FIS

1

560558

3471841

19

19

15

79

1

4.96

0.71

0.75

17.9

12.7

27.4

-0.07

2

510906

3511050

10

11

2

20

1

6.45

0.81

0.84

Inf

52.2

Inf

-0.06

3

520834

3518105

7

8

2

29

2

5.26

0.78

0.81

13.5

8.7

24.4

-0.09

4

567504

3478529

7

11

0

0

1

4.58

0.71

0.73

7.5

3.1

16.2

-0.05

5

567930

3477919

8

10

0

0

1

4.66

0.74

0.78

7.4

3.7

13.4

-0.09

6

541988

3486290

5

7

0

0

1

5.50

0.72

0.68

Inf

26.2

Inf

0.08

7

594936

3533556

12

12

4

33

1

4.53

0.63

0.58

17.6

8.7

64.2

0.09

8

549066

3480211

10

12

3

30

2

5.65

0.79

0.81

33.1

15.5

348

-0.05

9

603435

3485393

9

13

1

11

2

3.06

0.54

0.54

2.7

1.8

6.7

-0.02

10

556976

3520186

15

16

0

0

1

4.33

0.70

0.74

Inf

75.7

Inf

-0.08

11

558781

3488127

17

17

17

100

1

5.54

0.80

0.81

30.7

18.7

67.5

-0.02

12

561038

3488403

22

23

0

0

2

5.62

0.79

0.75

323.1

72.3

Inf

0.04

13

556064

3492110

6

9

0

0

1

5.79

0.79

0.84

75.1

25.9

Inf

-0.11

14

593398

3528429

9

12

0

0

1

4.35

0.64

0.60

19.7

9.6

83.5

0.04

15

520105

3496453

19

22

0

0

1

6.05

0.80

0.83

94.4

35.1

Inf

-0.05

Table A1, continued.

Red-spotted toad

Site

UTM
Northing

UTM
Easting

N
All

N
with P

N
Adults

Percent Adults

Reps

AR

HE

HO

Ne

C.I.s for Ne

FIS

1

574944

3509235

11

12

0

0

2

3.88

0.65

0.69

6.9

3.3

11.7

-0.09

2

566670

3483820

8

8

0

0

1

5.81

0.83

0.78

Inf

287.2

Inf

0.03

3

564771

3481006

15

15

0

0

1

5.55

0.79

0.75

302.1

49.1

Inf

0.05

4

542015

3486332

17

18

0

0

3

5.05

0.76

0.70

20

14.4

30.1

0.07

5

597845

3530951

9

11

0

0

1

5.99

0.80

0.82

Inf

49.9

Inf

-0.05

6

603007

3485338

9

11

0

0

2

4.36

0.67

0.68

2.9

2.3

4.9

-0.03

7

559054

3516045

6

9

0

0

1

5.28

0.77

0.73

Inf

180.6

Inf

0.02

8

586216

3479036

13

13

13

100

1

5.08

0.75

0.76

7.8

5

11.8

-0.04

9

561774

3488938

22

24

17

77

3

4.87

0.72

0.67

37.6

25.2

65.8

0.06

10

561034

3488404

6

6

0

0

1

5.93

0.79

0.72

Inf

Inf

Inf

0.05

11

556119

3492102

48

48

25

52

5

5.61

0.80

0.82

46.4

37.7

58.5

-0.04

12

592703

3528123

10

15

0

0

1

5.52

0.76

0.74

83

37.2

Inf

0.00

13

520105

3496453

17

18

2

12

1

5.75

0.78

0.72

144.6

55.6

Inf

0.05

14

564872

3481987

31

33

27

87

3

5.54

0.78

0.80

81.5

50.8

176.4

-0.04

15

563972

3486799

11

11

2

18

2

5.22

0.76

0.76

641.9

34.8

Inf

-0.02

                             

Table A1, continued.

 

Mexican spadefoot

Site

UTM
Northing

UTM
Easting

N
All

N
with P

N
Adults

Percent Adults

Reps

AR

HE

HO

Ne

C.I.s for Ne

FIS

1

561802

3489747

36

36

17

47

3

5.26

0.67

0.64

1903.3

87.1

Inf

0.03

2

584463

3505799

21

21

21

100

1

4.86

0.68

0.67

12.2

4.6

41.2

0.00

3

582676

3519097

23

23

0

0

1

5.31

0.69

0.72

Inf

63.7

Inf

-0.06

4

555732

3492251

12

12

12

100

1

5.56

0.67

0.75

Inf

48

Inf

-0.14

5

540672

3488698

33

33

0

0

2

5.40

0.65

0.66

Inf

314.2

Inf

-0.01

6

593537

3505547

34

34

0

0

1

5.05

0.65

0.62

Inf

10400

Inf

0.04

7

580834

3528180

72

72

0

0

3

5.21

0.67

0.67

1157.8

132.2

Inf

-0.01

8

565055

3495225

36

36

0

0

2

5.41

0.69

0.67

377.7

78.6

Inf

0.07

9

564804

3519926

31

31

0

0

1

5.16

0.67

0.65

1845

64.3

Inf

0.02

10

565362

3484554

39

39

18

46

2

5.35

0.68

0.69

Inf

105

Inf

-0.01

11

530935

3511341

24

24

0

0

1

4.92

0.65

0.64

Inf

44.8

Inf

0.01

12

591925

3510598

16

16

16

100

2

5.08

0.67

0.70

Inf

32.7

Inf

-0.06

13

555249

3494145

36

36

0

0

1

5.47

0.68

0.65

Inf

67.5

Inf

0.03

14

586216

3479036

9

9

9

100

1

5.00

0.68

0.65

Inf

24.7

Inf

0.01

15

559400

3492783

34

34

20

59

3

5.16

0.65

0.65

82.5

32.7

Inf

-0.02

16

538646

3513134

25

25

25

100

1

5.30

0.64

0.60

618.9

50.5

Inf

0.05

17

611229

3484426

19

20

0

0

1

5.15

0.67

0.69

63.9

24.2

Inf

-0.05

18

542257

3468315

14

16

0

0

1

5.00

0.61

0.66

49.8

17.3

Inf

-0.09

19

567709

3481377

19

19

19

100

3

5.30

0.66

0.69

74.7

26.4

Inf

-0.06

20

514446

3516357

17

17

0

0

1

5.32

0.72

0.70

58.4

23.4

Inf

0.03

21

553502

3494577

74

74

9

12

3

5.34

0.66

0.65

Inf

147.3

Inf

0.01

22

531529

3530515

26

26

0

0

2

5.65

0.73

0.71

83.5

36.5

Inf

0.04

23

532978

3531631

25

25

0

0

1

5.26

0.69

0.68

Inf

160.3

Inf

0.00

24

598126

3513429

61

61

0

0

2

5.25

0.69

0.66

Inf

77.7

Inf

0.08

25

566518

3489137

19

19

4

21

1

5.52

0.69

0.68

79.1

28.9

Inf

0.01

26

564400

3487189

26

26

9

35

3

5.39

0.68

0.70

Inf

72.8

Inf

-0.03

 

Table A2. Locus, repeat length (di-, tri- or tetranucleotide), and primer sequences for the final microsatellite loci for red-spotted toads (Anaxyrus punctatus) and canyon treefrogs (Hyla arenicolor), developed by the Evolutionary Genetics Core Facility at Cornell University.

Canyon treefrog

Locus

Repeat

Forward primer (5' - 3')

Reverse primer (5' - 3')

ha40

tet

ACAACTCCCAGCATATATCTCTC

GTTCACTGTACTCAAATGGCCTC

ha280

tri

TCCTTCACACTCTAAGGTTGCTC

CGCACTTTATGAACAGATTTGCC

ha311

tet

ATAATTACAGTGATGCCGCCTTG

CAAGCAACCATCAACATATGTAGG

ha357

tet

TTGTATCACTTGTGCTATTGGGC

TAGTGCTGCATTTATGTGGAAGG

ha479

tet

GCATTGTTCAAGTATTACCAGGC

TGTTCTCACTTTGCAGTTGAAGG

ha568

tet

GAGGCAGATTAATAGGTGAACGG

CATCCAAACACATACATCAGGGC

ha664

tet

AATGCCACATGTAACTGAGTGTG

TCCATTACTAAAGTACACCAGCC

ha703

tet

AGGTAGGTAGGTGTGCTTACATG

ACACTTGTGTCTTGAGTCATTGAC

ha705

tet

ACAGAAGCTACACCTAACACCTC

AAATATTAACCACCGGAGTACCC

ha1435

tet

ACTAGGTCATTCATTAGATGTGGG

TGAAAGGCTTAACTCTTCCAAGC

ha1997

tet

TTCTAACAAAGCCTGAGACATCC

TTGGACCCTTTATGACTTGCTTG

ha2144

tet

TGGCCGGTGAGTGTATATCTATC

TTGGATACCTACCTCACAGTCTG

Red-spotted toad

Locus

Repeat

Forward primer (5' - 3')

Reverse primer (5' - 3')

ap71

tet

AACCCTTTGTGACAGAATGGTTC

TTTGGTTGTTCACATCTCTCTGG

ap213

tet

ATCTCATTTCCCTCAAACTGTGC

GAAACAGTGAGCCAAACATTCCC

ap360

tet

TGCTCAACACTACTGAAGACATC

AGGATCTGTCAGGAGCAGTTATC

ap1904

tri

CACGATGTGTCCCTCTTTGTTTG

GGAGTAGCAGAAGGAATGTTGTG

ap2524

di

CCAGAAGTCATATGATCAGCGTG

ATTCCACTGTTGTTACCACTGAC

ap3396

tet

GGCAAATGTCCACAAATGTACAG

TGAGTCAGATAAGCTAGATGTGGG

ap3587

tri

GACGGATGAGACCAACATAGAAC

GATTGAACAAGACAAGCCCAAAC

ap3591

tet

CCACATTAAATACTGGCGCCTAG

GACCGATTCTGCCATATCTGC

ap4565

tet

TGCATGCCACTGTAGATAATAGG

TAGAGATAGCACTTACACCTGGG

ap5418

tet

ACAAGTGGGTAGAAAGATATGGG

CAGGAGCTGCTGGAGAGTATTC

ap5818

tet

ACCTTGAATTCTTTGTCATGTTCC

CCAGGGAGCCATTATTTCAGATG

ap6204

tet

CTGCTGCAACTGACACTG

AAACATACAAGGCTGACTATGGG

ap9886

tri

TGCGTGTTTCCATGTACCATATG

CAGTACAGTGTGGATGTGAAAGG

ap10273

tri

ACCAATATCTATCCTCCGACGTC

ATGTGAGAATAGGTTAGCGTTCC

 

Table A3. P values for Hardy Weinberg exact test for each population (rows) and locus (columns). Significant p values with a Bonferroni correction applied are shown in bold. No data (na) indicates that only one allele was present for a given locus in a given population, or two alleles were detected but one was represented by only one copy.

Canyon treefrog

 

280

357

40

664

1435

2144

311

705

1997

479

568

703

1

0.353

0.223

0.291

0.490

0.344

0.642

0.937

0.338

0.841

0.515

0.739

0.064

2

0.483

0.501

0.208

0.779

0.910

0.624

0.783

0.255

1.000

0.823

0.576

1.000

3

0.404

0.745

0.424

0.291

0.106

0.617

1.000

0.991

0.819

0.739

1.000

0.867

4

0.764

0.782

0.182

0.345

0.159

0.266

0.142

0.127

0.021

0.273

0.391

0.263

5

0.409

0.786

0.496

0.667

0.654

0.367

0.219

0.810

0.198

0.900

0.113

0.944

6

0.007

0.011

0.106

0.232

0.305

0.440

0.849

1.000

0.433

0.805

0.559

0.661

7

na

1.000

0.039

0.140

0.071

0.255

0.343

0.160

0.802

0.429

0.928

0.555

8

0.769

0.482

0.619

0.314

0.881

0.608

1.000

0.178

0.989

0.321

0.008

0.812

9

1.000

1.000

0.028

0.938

0.263

0.036

0.566

0.457

0.015

0.089

0.026

0.119

10

0.889

0.821

0.261

1.000

0.479

0.400

0.372

0.886

0.353

0.872

0.823

0.972

11

0.912

0.756

0.126

0.834

0.024

0.957

0.368

0.580

0.189

0.849

0.687

0.399

12

0.550

0.228

0.630

0.443

0.026

0.330

0.016

0.857

0.421

0.183

0.115

0.037

13

0.251

0.026

0.741

0.152

0.591

0.683

0.245

0.442

0.766

0.315

0.101

0.016

14

na

0.595

0.080

0.341

1.000

0.404

0.909

0.158

0.035

0.725

0.133

0.823

15

0.780

0.057

0.521

0.892

0.588

0.078

0.355

0.688

0.713

0.377

0.653

0.862

Table A3, cont'd.

Red-spotted toad

 

10273

2524

3396

5818

3591

360

6204

71

213

3587

1904

4565

5418

9886

1

0.304

0.227

0.400

0.119

0.653

0.219

na

0.722

0.471

0.174

1.000

0.774

0.258

0.530

2

0.089

0.378

0.759

0.696

0.866

0.887

0.434

1.000

0.223

0.191

0.069

0.855

0.189

0.766

3

0.384

0.032

0.622

0.001

0.971

0.996

0.047

0.749

0.188

0.071

1.000

0.672

0.250

0.117

4

0.853

0.032

0.934

0.047

0.375

0.139

1.000

0.965

0.584

0.317

0.116

0.256

0.620

0.260

5

0.983

0.795

0.775

0.271

0.715

0.516

1.000

0.980

0.680

0.053

0.932

0.679

1.000

0.754

6

0.511

0.098

0.140

0.076

0.182

0.568

1.000

0.739

0.669

0.160

1.000

0.011

0.084

0.654

7

0.742

0.665

0.627

0.878

0.688

0.652

1.000

0.345

0.527

1.000

1.000

0.339

0.463

0.648

8

0.982

0.063

0.552

0.454

1.000

0.027

0.602

0.110

0.037

0.057

0.743

0.215

0.173

0.468

9

0.322

0.385

0.607

0.127

0.095

0.275

1.000

0.148

0.537

0.025

0.173

0.052

0.218

0.693

10

0.148

0.655

1.000

0.003

0.430

0.709

1.000

0.760

0.163

0.379

1.000

0.213

1.000

0.585

11

0.002

0.077

0.284

0.804

0.933

0.053

0.867

0.854

0.267

0.046

0.057

0.076

0.362

0.224

12

0.438

1.000

0.116

0.193

0.209

0.115

0.729

0.516

0.366

0.388

1.000

0.283

0.644

0.896

13

0.008

0.033

0.941

0.008

0.274

0.688

1.000

0.112

0.411

0.053

1.000

0.605

0.830

0.335

14

0.310

0.128

0.150

0.826

0.740

0.987

0.091

0.834

0.281

0.483

0.549

0.013

0.260

1.000

15

0.881

0.461

0.163

0.857

0.719

0.076

0.538

0.364

0.125

0.342

0.554

0.760

0.897

0.188

Table A3, continued.

Mexican spadefoot

 

C7

D125

H115

D103

D111

D7

H129

20

1

0.942

0.081

0.563

0.057

0.804

1.000

0.884

0.564

2

0.072

0.443

0.026

0.409

0.400

1.000

0.234

0.228

3

0.906

0.337

0.828

0.133

0.918

1.000

0.496

0.504

4

0.012

0.874

0.259

0.260

0.724

na

0.293

0.387

5

0.809

0.072

0.883

0.534

0.747

na

0.348

0.448

6

0.300

0.073

0.888

0.106

0.588

na

0.408

0.766

7

0.698

0.016

0.340

0.547

0.100

1.000

0.309

0.487

8

0.363

0.046

0.281

0.419

0.710

0.084

0.522

0.351

9

0.275

0.521

0.135

0.829

0.980

na

0.188

0.740

10

0.717

0.811

0.898

0.166

0.763

na

0.157

0.941

11

0.129

0.687

0.350

0.002

0.997

na

0.094

0.893

12

0.660

0.840

0.465

0.492

0.499

na

0.232

0.591

13

0.415

0.652

0.382

0.039

0.312

na

0.496

0.378

14

0.842

0.650

0.421

0.099

0.879

na

0.302

0.976

15

0.423

0.339

0.015

0.210

0.457

na

1.000

0.268

16

0.529

0.323

0.664

0.255

0.167

na

0.018

0.462

17

0.585

0.086

0.127

0.965

0.828

na

0.442

0.642

18

0.411

0.519

0.305

0.465

0.340

na

1.000

0.083

19

0.831

0.666

0.129

0.916

0.401

na

0.327

0.361

20

0.818

0.181

0.071

0.902

0.955

0.431

0.725

0.745

21

0.589

0.576

0.252

0.526

0.807

na

0.613

0.468

22

0.902

0.332

0.217

0.197

0.607

0.297

0.462

0.991

23

0.832

0.237

0.284

0.355

0.554

1.000

0.574

0.000

24

0.967

0.907

0.300

0.160

0.902

0.002

0.147

0.732

25

0.879

0.574

0.831

0.657

0.831

na

0.239

0.286

26

0.963

0.835

0.208

0.897

0.710

na

0.865

0.322

 

Table A4. Characteristics of final microsatellite loci data sets for each species. Expected heterozygosity, observed heterozygosity, variability in PCR product size (Var), variability in PCR repeat number (VarRepN), allelic characteristics, and F statistics are shown. Additional information available upon request from M. C. Mims.

Canyon treefrog 

 

 

 

 

 

 

 

 

Locus

HE

HO

Var

VarRepN

Allele

FIS

FST

FIT

Min

Mean

Max

Richness

40

0.79

0.77

151.5

9.47

305

383.88

413

7.75

0.03

0.11

0.14

280

0.52

0.48

39.02

4.34

261

269.16

279

3.82

0.06

0.12

0.17

311

0.75

0.79

69.76

4.36

199

210.7

235

6.6

-0.05

0.13

0.08

357

0.66

0.71

21.85

1.37

204

214.81

232

4.62

-0.08

0.10

0.03

479

0.78

0.77

159.47

9.97

275

300.22

335

8.11

0.00

0.15

0.15

568

0.79

0.8

383.77

23.99

332

384.07

432

9.2

0.00

0.15

0.15

664

0.68

0.72

201.42

12.59

291

315.27

369

7.16

-0.06

0.19

0.14

703

0.84

0.83

644.4

40.28

305

397.43

499

9.19

0.00

0.09

0.10

705

0.77

0.79

394.52

24.66

320

360.16

416

7.33

-0.03

0.11

0.09

1435

0.77

0.77

298.06

18.63

178

307.3

375

7.32

0.02

0.13

0.14

1997

0.78

0.84

459.77

28.74

243

271.88

327

7.74

-0.09

0.14

0.07

2144

0.62

0.62

21.26

1.33

174

180.43

198

4.46

0.01

0.16

0.17

Red-spotted toad 

 

 

 

 

 

 

 

 

Locus

HE

HO

Var

VarRepN

Allele

FIS

FST

FIT

Min

Mean

Max

Richness

71

0.84

0.85

123.98

7.75

233

335.74

365

6.58

-0.01

0.04

0.03

213

0.87

0.83

2266.66

141.67

258

367.51

430

7.27

0.02

0.04

0.06

360

0.83

0.85

86.57

5.41

376

396.41

416

6.55

-0.01

0.05

0.04

1904

0.56

0.58

15.53

1.73

280

291.49

298

3.33

-0.06

0.04

-0.02

2524

0.72

0.69

17.44

4.36

365

382.32

391

5.05

0.05

0.05

0.10

3396

0.86

0.9

154.33

9.65

242

266.35

310

7.33

-0.04

0.04

0.00

3587

0.72

0.67

21.67

2.41

132

143.51

159

4.85

0.09

0.08

0.16

3591

0.72

0.75

155.3

9.71

316

332.05

438

5.51

-0.05

0.03

-0.02

4565

0.87

0.85

344.37

21.52

324

361.4

424

7.7

0.02

0.04

0.06

5418

0.91

0.89

1864.16

116.51

286

359.4

490

9.28

0.01

0.03

0.05

5818

0.86

0.73

135.15

8.45

408

435.82

496

6.01

0.10

0.02

0.12

6204

0.44

0.42

75.94

4.75

159

184.95

191

2.57

-0.02

0.07

0.05

9886

0.62

0.59

71.82

7.98

203

217.94

233

3.73

0.02

0.04

0.07

10273

0.83

0.78

156.83

17.43

325

355.76

376

5.87

0.06

0.04

0.10

Table A4, continued.

Mexican Spadefoot

 

 

 

 

 

 

 

 

 

Locus

HE

HO

Var

VarRepN

Allele

FIS

FST

FIT

Min

Mean

Max

Richness

20

0.86

0.86

82.69

5.17

150

178.23

202

7.86

0.00

0.01

0.02

C7

0.8

0.81

89.23

5.58

232

243.26

268

6.3

-0.01

0.01

0.00

D103

0.69

0.68

77.36

4.84

133

140.55

169

5.24

0.03

0.00

0.03

D111

0.84

0.86

144.76

9.05

84

103.07

136

7.18

-0.01

0.02

0.00

D125

0.79

0.77

77.11

4.82

198

210.66

242

6.42

0.03

0.01

0.04

D7

0.07

0.06

4.77

0.3

212

212.4

232

1.56

0.14

0.02

0.16

H115

0.7

0.71

16.11

1.01

84

95.06

112

4.61

-0.01

0.01

0.00

H129

0.64

0.62

59.25

3.7

186

195.91

218

4.49

0.04

0.01

0.05

 

Table A5. STRUCTURE results and delta-K calculations for each species. Results are presented for each genetic cluster with best delta-K in bold, and clusters are shown in Fig. 2 of the main text.

CANYON TREEFROG

 

 

 

 

Canyon treefrog - all populations

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

1

-9093.82

0.18

NA

NA

NA

 

2

-8537.00

1.04

556.82

167.31

160.66

 

3

-8147.49

2.23

389.51

181.21

81.12

 

4

-7939.19

14.73

208.30

7.21

0.49

 

5

-7738.10

15.62

201.09

46.76

2.99

 

6

-7583.77

25.84

154.33

116.84

4.52

 

7

-7546.28

108.98

37.49

101.37

0.93

 

8

-7610.16

741.54

-63.88

190.59

0.26

 

9

-7483.45

523.98

126.71

10.71

0.02

 

10

-7367.45

95.81

116.00

187.83

1.96

 

11

-7439.28

134.99

-71.83

16.60

0.12

 

12

-7494.51

138.59

-55.23

22.23

0.16

 

13

-7571.97

91.26

-77.46

35.08

0.38

 

14

-7684.51

270.39

-112.54

66.86

0.25

 

15

-7730.19

186.78

-45.68

14.96

0.08

 

16

-7760.91

300.21

-30.72

NA

NA

Canyon treefrog - western group

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

1

-7356.15

0.39

NA

NA

NA

 

2

-6973.11

0.63

383.04

167.45

264.43

 

3

-6757.52

12.86

215.59

18.68

1.45

 

4

-6560.61

17.87

196.91

39.79

2.23

 

5

-6403.49

6.76

157.12

123.87

18.33

 

6

-6370.24

18.98

33.25

22.25

1.17

 

7

-6314.74

33.30

55.50

87.91

2.64

 

8

-6347.15

25.78

-32.41

77.86

3.02

 

9

-6457.42

124.04

-110.27

88.56

0.71

 

10

-6479.13

85.90

-21.71

8.46

0.10

 

11

-6509.30

70.28

-30.17

31.15

0.44

 

12

-6570.62

102.93

-61.32

56.82

0.55

 

13

-6688.76

189.85

-118.14

NA

NA

Canyon treefrog - northwestern group

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

1

-2462.50

0.57

NA

NA

NA

 

2

-2248.47

0.94

214.03

253.09

268.76

 

3

-2287.53

17.77

-39.06

23.63

1.33

 

4

-2302.96

14.28

-15.43

16.94

1.19

 

5

-2301.45

13.78

1.51

NA

NA

Canyon treefrog - Santa Rita group

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

1

-1690.58

0.38

NA

NA

NA

Table A5, continued.

 

 

 

 

 

 

2

-1693.03

3.14

-2.45

0.12

0.04

 

 

3

-1695.36

4.32

-2.33

5.49

1.27

 

 

4

-1692.20

1.00

3.16

NA

NA

 

Canyon treefrog - southwestern group

 

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

 

1

-4457.82

0.24

NA

NA

NA

 

 

2

-4292.70

33.15

165.12

4.37

0.13

 

 

3

-4131.95

11.36

160.75

105.96

9.33

 

 

4

-4077.16

17.13

54.79

87.08

5.08

 

 

5

-4109.45

160.49

-32.29

84.61

0.53

 

 

6

-4057.13

24.78

52.32

99.66

4.02

 

 

7

-4104.47

56.91

-47.34

4.32

0.08

 

 

8

-4156.13

63.66

-51.66

44.54

0.70

 

 

9

-4252.33

121.29

-96.20

NA

NA

 

Canyon treefrog - Huachuca and Canelo group

 

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

 

1

-2770.95

0.54

NA

NA

NA

 

 

2

-2754.07

5.33

16.88

53.81

10.09

 

 

3

-2791.00

30.92

-36.93

10.50

0.34

 

 

4

-2817.43

36.99

-26.43

45.92

1.24

 

 

5

-2889.78

57.80

-72.35

110.59

1.91

 

 

6

-2851.54

29.00

38.24

NA

NA

 

Canyon treefrog - Canelo group

 

 

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

 

1

-660.86

0.43

NA

NA

NA

 

 

2

-662.53

2.25

-1.67

2.25

1.00

 

 

3

-661.95

1.16

0.58

NA

NA

 

Canyon treefrog - northern Huachuca group

 

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

 

1

-2001.53

0.46

NA

NA

NA

 

 

2

-2030.85

38.31

-29.32

22.21

0.58

 

 

3

-2037.96

43.77

-7.11

25.50

0.58

 

 

4

-2019.57

28.44

18.39

NA

NA

 

Canyon treefrog - Carr Canyon group

 

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

 

1

-546.61

0.40

NA

NA

NA

 

 

2

-490.71

3.44

55.90

69.73

20.24

 

 

3

-504.54

13.51

-13.83

NA

NA

 

Canyon treefrog - eastern group

 

 

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

 

1

-1125.51

0.46

NA

NA

NA

 

 

2

-938.96

0.60

186.55

223.24

369.57

 

 

3

-975.65

20.74

-36.69

4.19

0.20

 

 

4

-1008.15

23.66

-32.50

NA

NA

 

Table A5, continued.

Canyon treefrog - Dragoons group

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

1

-687.94

0.69

NA

NA

NA

 

2

-689.36

1.76

-1.42

1.81

1.03

 

3

-688.97

1.51

0.39

0.18

0.12

 

4

-688.76

1.94

0.21

NA

NA

RED-SPOTTED TOAD

 

 

 

 

Red-spotted toad - all populations

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

1

-13215.02

0.46

NA

NA

NA

 

2

-12971.37

13.98

243.65

102.01

7.30

 

3

-12829.73

8.44

141.64

63.70

7.55

 

4

-12751.79

27.19

77.94

36.58

1.35

 

5

-12710.43

29.91

41.36

0.06

0.00

 

6

-12669.01

71.29

41.42

49.47

0.69

 

7

-12677.06

43.01

-8.05

30.23

0.70

 

8

-12654.88

64.53

22.18

116.90

1.81

 

9

-12749.60

178.93

-94.72

177.69

0.99

 

10

-13022.01

407.90

-272.41

298.99

0.73

 

11

-12995.43

403.13

26.58

325.88

0.81

 

12

-13294.73

468.77

-299.30

300.26

0.64

 

13

-13894.29

867.01

-599.56

929.46

1.07

 

14

-13564.39

505.81

329.90

753.24

1.49

 

15

-13987.73

953.76

-423.34

113.54

0.12

 

16

-14297.53

757.84

-309.80

NA

NA

Red-spotted toad - Huachuca group

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

1

-7728.50

0.40

NA

NA

NA

 

2

-7739.63

9.16

-11.13

5.23

0.57

 

3

-7745.53

76.76

-5.90

104.14

1.36

 

4

-7855.57

181.07

-110.04

125.11

0.69

 

5

-7840.50

283.73

15.07

293.10

1.03

 

6

-8118.53

159.93

-278.03

11.19

0.07

 

7

-8407.75

350.29

-289.22

442.65

1.26

 

8

-8254.32

234.76

153.43

NA

NA

Red-spotted toad - Northern group

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

1

-4553.32

0.32

NA

NA

NA

 

2

-4449.05

8.94

104.27

18.66

2.09

 

3

-4363.44

29.85

85.61

20.58

0.69

 

4

-4298.41

5.18

65.03

72.03

13.90

 

5

-4305.41

16.50

-7.00

26.40

1.60

 

6

-4338.81

52.72

-33.40

3.73

0.07

 

7

-4375.94

36.93

-37.13

59.32

1.61

Table A5, continued.

 

8

-4472.39

58.42

-96.45

9.56

0.16

 

9

-4559.28

174.10

-86.89

NA

NA

Red-spotted toad - Northern sub-group

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

1

-2372.74

0.48

NA

NA

NA

 

2

-2430.49

33.76

-57.75

35.43

1.05

 

3

-2452.81

87.30

-22.32

79.44

0.91

 

4

-2395.69

26.53

57.12

52.34

1.97

 

5

-2390.91

33.63

4.78

NA

NA

MEXICAN SPADEFOOT

 

 

 

 

Mexican spadefoot - all populations

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

1

-19503.12

0.18

NA

NA

NA

 

2

-19351.07

6.00

152.05

68.00

11.33

 

3

-19267.02

11.99

84.05

104.55

8.72

 

4

-19287.52

41.90

-20.50

110.89

2.65

 

5

-19418.91

160.98

-131.39

59.02

0.37

 

6

-19491.28

197.55

-72.37

1.44

0.01

 

7

-19565.09

289.89

-73.81

51.89

0.18

 

8

-19587.01

270.93

-21.92

9.04

0.03

 

9

-19617.97

181.86

-30.96

130.94

0.72

 

10

-19779.87

355.34

-161.90

284.66

0.80

 

11

-19657.11

235.36

122.76

277.71

1.18

 

12

-19812.06

273.94

-154.95

139.42

0.51

 

13

-19827.59

271.40

-15.53

212.04

0.78

 

14

-19631.08

210.34

196.51

250.04

1.19

 

15

-19684.61

217.28

-53.53

36.77

0.17

 

16

-19774.91

149.92

-90.30

158.59

1.06

 

17

-19706.62

130.22

68.29

258.44

1.98

 

18

-19896.77

365.91

-190.15

310.33

0.85

 

19

-19776.59

168.08

120.18

17.39

0.10

 

20

-19673.80

185.09

102.79

136.42

0.74

 

21

-19707.43

107.20

-33.63

8.41

0.08

 

22

-19732.65

220.54

-25.22

100.37

0.46

 

23

-19657.50

80.49

75.15

90.43

1.12

 

24

-19672.78

127.48

-15.28

59.26

0.46

 

25

-19747.32

242.03

-74.54

9.78

0.04

 

26

-19812.08

334.43

-64.76

NA

NA

Mexican spadefoot - Santa Rita group

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

1

-1758.44

0.53

NA

NA

NA

 

2

-1797.04

29.55

-38.60

14.24

0.48

 

3

-1821.40

37.96

-24.36

1.36

0.04

 

4

-1847.12

29.46

-25.72

NA

NA

Table A5, continued.

Mexican spadefoot - Huachuca group

 

 

 

 

K

Mean LnP(K)

Stdev LnP(K)

Ln'(K)

|Ln''(K)|

Delta K

 

1

-17565.59

0.07

NA

NA

NA

 

2

-17497.87

10.61

67.72

129.18

12.17

 

3

-17559.33

32.91

-61.46

24.50

0.74

 

4

-17596.29

83.92

-36.96

128.06

1.53

 

5

-17761.31

154.30

-165.02

0.93

0.01

 

6

-17927.26

178.78

-165.95

141.40

0.79

 

7

-17951.81

204.93

-24.55

95.89

0.47

 

8

-18072.25

302.79

-120.44

260.18

0.86

 

9

-17932.51

263.72

139.74

245.68

0.93

 

10

-18038.45

226.66

-105.94

96.13

0.42

 

11

-18048.26

243.41

-9.81

84.39

0.35

 

12

-17973.68

275.75

74.58

120.49

0.44

 

13

-18019.59

335.17

-45.91

109.97

0.33

 

14

-17955.53

137.98

64.06

69.75

0.51

 

15

-17961.22

154.04

-5.69

100.90

0.66

 

16

-18067.81

303.65

-106.59

266.85

0.88

 

17

-17907.55

147.00

160.26

261.14

1.78

 

18

-18008.43

248.44

-100.88

31.08

0.13

 

19

-18140.39

380.27

-131.96

285.94

0.75

 

20

-17986.41

220.01

153.98

87.47

0.40

 

21

-17919.90

158.72

66.51

41.97

0.26

 

22

-17895.36

169.39

24.54

52.57

0.31

 

23

-17923.39

144.17

-28.03

74.31

0.52

 

24

-17877.11

110.27

46.28

NA

NA

 

Table A6. Comparison of allelic richness, observed and expected heterozygosity, Ne (median estimate and the count of upper confidence intervals that include infinite population sizes), and genetic differentiation (G'ST) between sampling methods for red-spotted toads and spadefoots.

Red-spotted toad

 

Allelic
richness

HO

HE

Ne

Ne infinite
C. I.

G'ST

Adults

5.781

0.776

0.764

81.8

2 of 4

0.235

Larvae

5.673

0.749

0.772

35.0

1 of 4

0.380

Mexican spadefoot

 

Allelic
richness

HO

HE

Ne

Ne infinite
C. I.

G'ST

Adults

4.985

0.667

0.664

618.90

10 of 11

0.103

Larvae

5.020

0.654

0.673

Infinite

10 of 11

0.077

Breeding Adults

4.937

0.656

0.667

732.10

6 of 6

0.102

Roadside Adults

5.024

0.677

0.661

197.60

4 of 5

0.099

 

Table A7. Spatial and temporal sampling replicates and genetic diversity (expected and observed heterozygosity, allelic richness, Ne, and the upper confidence interval for Ne estimate calculated via a jackknifing method). Significant results shown in bold font.

All species

Paired t test

t

p val

  HE

 1.723

0.100

  HO

-1.128

0.273

  AR

 1.191

0.248

Wilcoxon signed-rank test

V

p val

  Ne

101

0.5136

  Ne (upper C.I.)

22

1

Canyon treefrog and red-spotted toads

Paired t-test

t

p val

  HE

 2.777

0.024

  HO

-0.378

0.715

  AR

 1.707

0.126

Wilcoxon signed-rank test

V

p val

  Ne

19

0.944

  Ne (upper C.I.)

9

0.447


[Back to E096-122]